SUMO - Sequence logo

WikiPedia explains:

In bioinformatics, a sequence logo is a graphical representation of the sequence conservation of nucleotides (in a strand of DNA/RNA) or amino acids (in protein sequences).[1] A sequence logo is created from a collection of aligned sequences and depicts the consensus sequence and diversity of the sequences. Sequence logos are frequently used to depict sequence characteristics such as protein-binding sites in DNA or functional units in proteins.

The "width" of a character stack at a sequence position represents the proportion of residues versus "gaps"/non residue symbols.
A position with many "gaps " is smallest.
The hight of the complete stack resprents the "purity": a position with only one residue type is highest, the stack of a position with 2 or more residues is shown smaller.
Within a stack, the most abundant residue is shown on top, largest, the others with decreasing hight below.
Hight of a residue within a stack is not absolutetly proportional to its abundance.
Minimum hight is kept to make a residue character readable
Individual residues are colored following specific staining schemes.
Color schemes may depict certain physical or biological properties of the residues.

Select SUMO main menu | Utilities | Sequence logo

Open SequenceLogo utilitiy upon SUMO startup (Click arrow to view more):

Create a link to SUMO within Windows' file explorer.
Modify the target (Right_mouse click the link, select Properties from context menu:

PATH_TO_SUMO\SUMO.exe /uitlities.seqlogog /iconize

Enter a set of ALIGNED sequences:

DNA : characters A,C,G,T,U
Protein one letter codes : A,R,N,D,C,Q,E,G,H,I,L,K,M,F,P,S,T,W,Y,V,B,X,Z
"Gaps" : '.', '-'
!! ANY OTHER CHARACTERS: IGNORED !!
SUMO tries to estimate the sequence type on residue character composition

As plain text:
- One sequence per line
- Only residue characters or "gaps"
- no sequence names, counting, spaces, tabs, ...

------gatTCTCACGTCG
-----cgatATAGAGCTAT
----tcgatTAGCATATGT
---atcgatCGTCTATGTC
--gatcgatCACGCACAGA
-cgatcgatACAGCGTGCA
acgatcgatTGTCTCAGAG
--------tCGACTCATCT
-------atAGCGTCGTCT
------.gatCGACGTGAC
.....cgatCTATAGCGTA

Multiple FASTA:
- For each sequence ONE header line starting with ">"
- Followed by one or multiple sequence lines,
- only residue characters and "gaps"

>S-2_;
........NGATAGACTATACTACTGACTGCAGTCTGAGTCTGACAG.CG
ATCTCGATCGATACTACTATGTAGCAGAG.CTACGCACTCTATGCTAGTA
CGCTATAGATCN.............................
>S-2590_;
.........NATCTACACGTGCACTGACTGCAGTCTGAGTCTGACAGTCG
AT..CGAT....ACTACTATGTAGCAGAG.CTACGCACTCTATGCTAGCG
.ACGTGAGAATCAGATCGNA...............T.....
>S-232_;
..........NTATAGAGTACTACTGACTGCAGTCTGAGTCTGACAGG..
.....................TAGCAGAG.CTACGCACTCTATGCTAGAG
ACGACGCTAT..AGATCGGAAGAGCGGTTCAGCAGGANT...........
.........................................
>S-1712_;
..........NTCTGAGCTAGAACTGACTGCAGTCTGAGTCTGACAGG..
........................CAGAG.CTACGCACTCTATGCTAGGC
.GCTATCTGAT.AGATCGGAAGAGCGGTTCAGCAGGAATGN
>S-2233_;
......NTCGATTGCGCGTCTAACTGACTGCAGTCTGAGTCTGACAG...
......................AGCAGAG.CTACGCACTCTATGCTAGGA
.CATAGACGATC.GAT.AGATCGGAAGAGCGGTTCAN....
>S-1264_;
...NCGATCGATTAGTAGCTACACTGACTGCAGTCTGAGTCTGACAG...
....................CTAGCAGAG.CTACGCACTCTATGCTAGCA
.CTGAGACAATC.GAT.CGTAGATCGGAAGA..........

Clustal format:
- The first line starts with the word
CLUSTAL W or CLUSTALW
- After the above header there is at least one empty line
- Finally, one or more blocks of sequence data are following, where each block is separated by at least one empty line.
- Each line in a blocks of sequence data consists of the sequence name followed by the sequence symbols, separated by at least one whitespace character.
- Optionally, an additional whitespace separated cumulative residue count may follow the sequence symbols - ignored.
- Optionally, a block may be followed by a line depicting the degree of conservation of the respective alignment columns - ignored.

clustalw.aln

S-232__         -------NTATAGAGTACTACTGACTGCAGTCTGAGTCTGACAGG---------------
S-2233__        ---NTCGATTGCGCGTCTAACTGACTGCAGTCTGAGTCTGACAG----------------
S-1264__        NCGATCGATTAGTAGCTACACTGACTGCAGTCTGAGTCTGACAGC---------------
S-1712__        -------NTCTGAGCTAGAACTGACTGCAGTCTGAGTCTGACAG----------------
S-2__           -----NGATAGACTATACTACTGACTGCAGTCTGAGTCTGACAGCGATCTCGATCGATAC
S-2590__        ------NATCTACACGTGCACTGACTGCAGTCTGAGTCTGACAG-----TCGATCGATAC
                        *          *************************                

S-232__         -------TAGCAGAGCTACGCACTCTATGCTAG-----AGACGACGCTATAGATCGGAAG
S-2233__        --------AGCAGAGCTACGCACTCTATGCTAGGACATAGACGAT-CGATAGATCGGAAG
S-1264__        -------TAGCAGAGCTACGCACTCTATGCTAG-----CACTGAGACAATCGATCG-TAG
S-1712__        ---------GCAGAGCTACGCACTCTATGCTAG-----GCGCTATCTGATAGATCGGAAG
S-2__           TACTATGTAGCAGAGCTACGCACTCTATGCTAGT-----ACG----CTATAGATCN----
S-2590__        TACTATGTAGCAGAGCTACGCACTCTATGCTAGCG----ACGTGAGAATCAGATCGNAT-
                         ************************               : .****.

Paste a set of aligned sequences from clipboard ( Clipboard => text box button or drag a multiple alignment file from Windows' file explorer into the Sequence text box.

Click the Process button to generate the Sequence logo:

Copy the graph to Clipboard or save as image file.

SUMO extracts a "majority" sequence from the multiple aligned sequences, taking the maximal abundant residue (i.e. character top in residue stacks) at each alingment positon. Kind of a "maximum intensity projection".
The resulting sequence is shown in Info tab-sheet, and may be copied from there:

Customize the graph

Click the Tool-button to view the tool-box:

Font Size Change the font size.
At present, minimum height/width of a character is limited to at least 10 pixels to allow readability. Click Apply button.

Residue numbering
Define the interval at which residure numbers are shone on x-axis.
"1" for every residue, "5" for every fith residue ...

Offset
Maybe you want to indicate the offstream residues relative to a certain feature.
The resdiues until OFFSET are counted negative, numbers at offset start with 1:

Color scheme Select different color schemes to visualize certain - conserved - properties of the sequences (e.g. hydophobity of amino acids in protein alignments).

Residue Colour Schemes

Nucleotide

Purine/Pyrimidine

Protein Colour Schemes

Hydrophobicity¹

Helix Propencity²

Strand Propencity²

Turn Propencity²

Buried Index³

Clustal⁴

Zappo⁵

Taylor⁶

GECOS Flower⁷

GECOS Blossom⁷

GECOS Sunset⁷

GECOS Ocean⁷

Residues are colored in respect to their hydrophobicity.
Hydrophobic-red, hydrophilic-blue.
Kyte J, Doolittle RF.
A simple method for displaying the hydropathic character of a protein.
(1982) J Mol Biol., 157, 105-132
Preference of residue to form a α-helix, β-fold, bend
Levitt M. (1978)
Conformational preferences of amino acids in globular proteins.
Biochemistry, 17, 4277-4285
Relativ to the frequency of occurrence inside globules
Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994)
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice.
Nucleic Acids Research, 22:4673-4680.
- Hydrophobic (A,F,I,L,M,V,W) - Negative charged (D,E) - Positive charged (K,R) - Polar (S,T,Q,N) - Cysteine (C) - Glycines (G) - Proline (P) - Aromatic (H,Y)
Zappo:
Residues are coloured according to their physicochemical properties as follows:
- Aliphatic/hydrophobic (I,L,V,A,M)
- Aromatic (F,W,Y)
- Positive (K,R,H)
- Negative (D,E)
- Hydrophilic (S,T,N,Q) - Conformationally special (P,G) - Cysteine (C)
Taylor WR. (1997)
Residual colours: a proposal for aminochromography.
Protein Eng., 10, 743-746
Color schemes basesed on AA-replacement matrix BLOSUM62
P. Kunzmann, B. E. Mayer, K. Hamacher
Substitution matrix based color schemes for sequence alignment visualization
BMC Bioinformatics, vol. 21, pp. 209, May 2020. doi: 10.1186/s12859-020-3526-6
- Flower: Light color scheme
- Blossom: Light color scheme with high contrast, depicts symbol similarity worse than flower
- SunSet: Red-green color vision deficiency adapated
- Ocean: Blue shifted, light color scheme

Modify a color scheme, by changing individual residues' color.
- Select a Residue character from the Symbol drop down list.
- Click the ... button to open a color picker.

Save the modified color scheme as text file

#SUMO_SequenceLogo_ColorScheme
-	rgb(192,192,192)
A	rgb(240,240,240)
C	rgb(128,128,128)
G	rgb(72,72,72)
T	rgb(0,0,0)
R	rgb(5,5,5)
N	rgb(5,5,5)
D	rgb(192,192,192)
Q	rgb(0,0,0)
...

Load a color list, with the above format.

Show residues as:

Symbol: Base/AA characters
Boxes: to reduce the view to the conserved functionality indicated b the color:

Decorations

To highligth certain regions in the Sequence Logo you may place rectangles, top or bottom lines over the logo:

Go to Info tab sheet and type a decoration command:


deco.add=type=frame;start=5;stop=10;pen.color=red;pen.width=5;

will place a red box around residues 5-10 using 5 pixel wide stroke.

Object command
type=rect type=bottomline type=topline	Plot a rectangle, line on top or bottom of the sequence region, respectively Default= rectangle
start=xx	first residue, where to start the rectangle/line REQUIRED
stop=xx	last residue, where to start the rectangle/line REQUIRED
pen.color=color	the color for the rect/line: - red,green,blue,yellow,navy,maroon,purple,teal,olive, aqua,lime,fuchsia,black,gray,silver,white - any color: rgb(rrr,ggg,bbb), e.g. rgb(255,0,0) = bright redy Defaultb= black
pen.width=xx	width of line stroke in pixel Default=3

You may connect multiple decoration objects with " && " in a single line.


deco.add=type=frame;start=5;stop=6;pen.color=red; && type=frame;start=9;stop=10;pen.color=red; && type=bot;start=7;stop=8;pen.color=maroon; && type=top;start=1;stop=4;pen.color=black

Would generate the decoration in the example image above.

Commands
decoration.add=	add a single (or multipe) objects
decoration.list	List all defined decoration objects
decoration.clear	Remove all defined decoration objects
decoration.delete=xx	Remove decoration object xx

To show the graph with newly defined decorations, click Process button.